Strain Information | |
---|---|
DGRC Number | 112736 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP1623 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP1623 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 44D4 |
Map Viewer | |
Related Genes | Cirl CG8642 |
Original Number | 1623 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP1623 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 599 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | pns subset (SG) |
Larval GFP | tr |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np26435_0807 |
Strand | Minus |
Insertion Point | 3675440 |
Chromosome Band | 2R |
Flanking Sequence | ggntttttnngtgcactgacnttaagtgtatacttcggtaagcttcggctatcgacggga ccaccttatgttatttcatcatgCTTGAATGTCTGGTTGAAGCTGGAGGGTGTTGCCAGC CTAAAAACGCAATTATCGGACTGCCAACTTGCTGCTGAGAAGAGCGCGCAATTCAAATAG GAAAGTAACGTGGTGATTGTTATGCATACATCGAAGACAAATTACTTATTGATAAATACA AACATATTTAACTGTTTAAAAGTCCTTTGAAAGTGCATAAATGTACTTCGTATTATTATT CACTTTGAGTTTCTTAACGAGTTAAGATACAGTTTAAAATCACCTCAAAATCTTTATCAT GCTGGCTAAAAGTAATATTATTTAGTAAAAATAGTAAAAATATTTTTTCTATATCAGCGG GAGCAGTAATAAAAAGGGCATCAGTTTGAAAAGGTATGCTGCATCAAGTTTCACgatcga agaatacataagagagaaccgtcgccaaagaacccattattggtgggggtcccgtttcan gaagggcaagccatccgacatgtcatcctcttcaganccaatcaaatccatgaagagcat ncctggggcataaaaatccaccggaattgnggagttatcatgatgagctgccgagtcaat cgatacagncaactggctttgacctttggtactactctcttccgatgatgatgtcgcact tattctatgctgnctcaatgttagaggcatatcagtctcactggctnnnnttnnnnnggg gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncn |